Please note: this site relies heavily on the use of javascript. Without a javascript-enabled browser, this site will not function correctly. Please enable javascript and reload the page, or switch to a different browser.
33  structures 1444  species 4  interactions 2205  sequences 46  architectures

Family: RNA_pol (PF00940)

Summary: DNA-dependent RNA polymerase

Pfam includes annotations and additional family information from a range of different sources. These sources can be accessed via the tabs below.

This is the Wikipedia entry entitled "T7 RNA polymerase". More...

T7 RNA polymerase Edit Wikipedia article

T7 RNA polymerase
T7 RNA polymerase.jpg
T7 RNA Polymerase (blue) producing mRNA (light-blue) from a double-stranded DNA template (orange).
Identifiers
OrganismT7 phage
Symbol1
PDB1MSW (ECOD)
UniProtP00573

T7 RNA Polymerase is an RNA polymerase from the T7 bacteriophage that catalyzes the formation of RNA from DNA in the 5'→ 3' direction.

Activity

T7 polymerase is extremely promoter-specific and transcribes only DNA downstream of a T7 promoter.[1] The T7 polymerase also requires a double stranded DNA template and Mg2+ ion as cofactor for the synthesis of RNA. It has a very low error rate. T7 polymerase has a molecular weight of 99 kDa.

Promoter

The promoter is recognized for binding and initiation of the transcription. The consensus in T7 and related phages is:[1]

5’                    *      3‘
T7   TAATACGACTCACTATAGGGAGA
T3   AATTAACCCTCACTAAAGGGAGA
K11  AATTAGGGCACACTATAGGGAGA
SP6  ATTTACGACACACTATAGAAGAA
  bind------------
                 -----------init

Transcription begins at the asterisk-marked guanine.[1]

Structure

T7 polymerase has been crystallised in several forms and the structures placed in the PDB. These explain how T7 polymerase binds to DNA and transcribes it. The N-terminal domain moves around as the elongation complex forms. The ssRNAP holds a DNA-RNA hybrid of 8bp.[2] A beta-hairpin specificity loop (residues 739-770 in T7) recognizes the promoter; swapping it out for one found in T3 RNAP makes the polymerase recognize T3 promoters instead.[1]

Similar to other viral nucleic acid polymerases, including T7 DNA polymerase from the same phage, the conserved C-terminal of T7 ssRNAP employs a fold whose organization has been likened to the shape of a right hand with three subdomains termed fingers, palm, and thumb.[3] The N-terminal is less conserved. It forms a promoter-binding domain (PBD) with helix bundles in phage ssRNAPs,[4] a feature not found in mitochondrial ssRNAPs.[5]

Related proteins

DNA-directed RNA polymerase, phage-type
Identifiers
SymbolRNA_pol
PfamPF00940
InterProIPR002092
SCOPe1msw / SUPFAM

T7 polymerase is a representative member of the single-subunit DNA-dependent RNAP (ssRNAP) family. Other members include phage T3 and SP6 RNA polymerases, the mitochondrial RNA polymerase (POLRMT), and the chloroplastic ssRNAP.[6][7] The ssRNAP family is structurally and evolutionarily distinct from the multi-subunit family of RNA polymerases (including bacterial and eukaryotic sub-families). In contrast to bacterial RNA polymerases, T7 polymerase is not inhibited by the antibiotic rifampicin. This family is related to single-subunit reverse transcriptase and DNA polymerase.[8]

Application

In biotechnology applications, T7 RNA polymerase is commonly used to transcribe DNA that has been cloned into vectors that have two (different) phage promoters (e.g., T7 and T3, or T7 and SP6) in opposite orientation. RNA can be selectively synthesized from either strand of the insert DNA with the different polymerases. The enzyme is stimulated by spermidine and in vitro activity is increased by the presence of carrier proteins (such as BSA)[9][10]

Homogeneously labeled single-stranded RNA can be generated with this system. Transcripts can be non-radioactively labeled to high specific activity with certain labeled nucleotides.

References

  1. ^ a b c d Rong M, He B, McAllister WT, Durbin RK (January 1998). "Promoter specificity determinants of T7 RNA polymerase". Proceedings of the National Academy of Sciences of the United States of America. 95 (2): 515–9. doi:10.1073/pnas.95.2.515. PMC 1845. PMID 9435223.
  2. ^ Tahirov TH, Temiakov D, Anikin M, Patlan V, McAllister WT, Vassylyev DG, Yokoyama S (November 2002). "Structure of a T7 RNA polymerase elongation complex at 2.9 A resolution". Nature. 420 (6911): 43–50. doi:10.1038/nature01129. PMID 12422209.
  3. ^ Hansen JL, Long AM, Schultz SC (August 1997). "Structure of the RNA-dependent RNA polymerase of poliovirus". Structure. 5 (8): 1109–22. doi:10.1016/S0969-2126(97)00261-X. PMID 9309225.
  4. ^ Durniak KJ, Bailey S, Steitz TA (October 2008). "The structure of a transcribing T7 RNA polymerase in transition from initiation to elongation". Science. 322 (5901): 553–7. doi:10.1126/science.1163433. PMC 2892258. PMID 18948533.
  5. ^ Hillen HS, Morozov YI, Sarfallah A, Temiakov D, Cramer P (November 2017). "Structural Basis of Mitochondrial Transcription Initiation". Cell. 171 (5): 1072–1081.e10. doi:10.1016/j.cell.2017.10.036. PMC 6590061. PMID 29149603.
  6. ^ McAllister WT, Raskin CA (October 1993). "The phage RNA polymerases are related to DNA polymerases and reverse transcriptases". Molecular Microbiology. 10 (1): 1–6. doi:10.1111/j.1365-2958.1993.tb00897.x. PMID 7526118.
  7. ^ Hedtke B, Börner T, Weihe A (August 1997). "Mitochondrial and chloroplast phage-type RNA polymerases in Arabidopsis". Science. 277 (5327): 809–11. doi:10.1126/science.277.5327.809. PMID 9242608.
  8. ^ Cermakian N, Ikeda TM, Miramontes P, Lang BF, Gray MW, Cedergren R (December 1997). "On the evolution of the single-subunit RNA polymerases". Journal of Molecular Evolution. 45 (6): 671–81. doi:10.1007/PL00006271. PMID 9419244.
  9. ^ Chamberlin M, Ring J (March 1973). "Characterization of T7-specific ribonucleic acid polymerase. 1. General properties of the enzymatic reaction and the template specificity of the enzyme". The Journal of Biological Chemistry. 248 (6): 2235–44. PMID 4570474.
  10. ^ Maslak M, Martin CT (June 1994). "Effects of solution conditions on the steady-state kinetics of initiation of transcription by T7 RNA polymerase". Biochemistry. 33 (22): 6918–24. doi:10.1021/bi00188a022. PMID 7911327.

Further reading

  • Martin CT, Esposito EA, Theis K, Gong P (2005). "Structure and function in promoter escape by T7 RNA polymerase". Progress in Nucleic Acid Research and Molecular Biology. 80: 323–47. doi:10.1016/S0079-6603(05)80008-X. ISBN 9780125400800. PMID 16164978.
  • Sousa R, Mukherjee S (2003). "T7 RNA polymerase". Progress in Nucleic Acid Research and Molecular Biology. 73: 1–41. doi:10.1016/S0079-6603(03)01001-8. ISBN 9780125400732. PMID 12882513.
  • McAllister WT (1993). "Structure and function of the bacteriophage T7 RNA polymerase (or, the virtues of simplicity)". Cellular & Molecular Biology Research. 39 (4): 385–91. PMID 8312975.
  • Sastry SS, Ross BM (March 1997). "Nuclease activity of T7 RNA polymerase and the heterogeneity of transcription elongation complexes". The Journal of Biological Chemistry. 272 (13): 8644–52. doi:10.1074/jbc.272.13.8644. PMID 9079696. - note that the nuclease activity reported here is an artifact.
  • Chamberlin M, Ring J (March 1973). "Characterization of T7-specific ribonucleic acid polymerase. 1. General properties of the enzymatic reaction and the template specificity of the enzyme". The Journal of Biological Chemistry. 248 (6): 2235–44. PMID 4570474.
  • Maslak M, Martin CT (June 1994). "Effects of solution conditions on the steady-state kinetics of initiation of transcription by T7 RNA polymerase". Biochemistry. 33 (22): 6918–24. doi:10.1021/bi00188a022. PMID 7911327.

External links

This page is based on a Wikipedia article. The text is available under the Creative Commons Attribution/Share-Alike License.

This tab holds the annotation information that is stored in the Pfam database. As we move to using Wikipedia as our main source of annotation, the contents of this tab will be gradually replaced by the Wikipedia tab.

DNA-dependent RNA polymerase Provide feedback

This is a family of single chain RNA polymerases.

External database links

This tab holds annotation information from the InterPro database.

InterPro entry IPR002092

DNA-directed RNA polymerases EC (also known as DNA-dependent RNA polymerases) are responsible for the polymerisation of ribonucleotides into a sequence complementary to the template DNA. In eukaryotes, there are three different forms of DNA-directed RNA polymerases transcribing different sets of genes. Most RNA polymerases are multimeric enzymes and are composed of a variable number of subunits. The core RNA polymerase complex consists of five subunits (two alpha, one beta, one beta-prime and one omega) and is sufficient for transcription elongation and termination but is unable to initiate transcription. Transcription initiation from promoter elements requires a sixth, dissociable subunit called a sigma factor, which reversibly associates with the core RNA polymerase complex to form a holoenzyme [PUBMED:3052291]. The core RNA polymerase complex forms a "crab claw"-like structure with an internal channel running along the full length [PUBMED:10499798]. The key functional sites of the enzyme, as defined by mutational and cross-linking analysis, are located on the inner wall of this channel.

RNA synthesis follows after the attachment of RNA polymerase to a specific site, the promoter, on the template DNA strand. The RNA synthesis process continues until a termination sequence is reached. The RNA product, which is synthesised in the 5' to 3' direction, is known as the primary transcript.

Eukaryotic nuclei contain three distinct types of RNA polymerases that differ in the RNA they synthesise:

  • RNA polymerase I: located in the nucleoli, synthesises precursors of most ribosomal RNAs.
  • RNA polymerase II: occurs in the nucleoplasm, synthesises mRNA precursors.
  • RNA polymerase III: also occurs in the nucleoplasm, synthesises the precursors of 5S ribosomal RNA, the tRNAs, and a variety of other small nuclear and cytosolic RNAs.

Eukaryotic cells are also known to contain separate mitochondrial and chloroplast RNA polymerases. Eukaryotic RNA polymerases, whose molecular masses vary in size from 500 to 700kDa, contain two non-identical large (>100kDa) subunits and an array of up to 12 different small (less than 50kDa) subunits.

The phage-type enzymes are family of single chain polymerases found in bacteriophages and mitochondria [PUBMED:7526118].

Gene Ontology

The mapping between Pfam and Gene Ontology is provided by InterPro. If you use this data please cite InterPro.

Domain organisation

Below is a listing of the unique domain organisations or architectures in which this domain is found. More...

Loading domain graphics...

Alignments

We store a range of different sequence alignments for families. As well as the seed alignment from which the family is built, we provide the full alignment, generated by searching the sequence database (reference proteomes) using the family HMM. We also generate alignments using four representative proteomes (RP) sets, the UniProtKB sequence database, the NCBI sequence database, and our metagenomics sequence database. More...

View options

We make a range of alignments for each Pfam-A family. You can see a description of each above. You can view these alignments in various ways but please note that some types of alignment are never generated while others may not be available for all families, most commonly because the alignments are too large to handle.

  Seed
(193)
Full
(2205)
Representative proteomes UniProt
(4275)
NCBI
(5379)
Meta
(424)
RP15
(604)
RP35
(1260)
RP55
(1762)
RP75
(2273)
Jalview View  View  View  View  View  View  View  View  View 
HTML View  View               
PP/heatmap 1 View               

1Cannot generate PP/Heatmap alignments for seeds; no PP data available

Key: ✓ available, x not generated, not available.

Format an alignment

  Seed
(193)
Full
(2205)
Representative proteomes UniProt
(4275)
NCBI
(5379)
Meta
(424)
RP15
(604)
RP35
(1260)
RP55
(1762)
RP75
(2273)
Alignment:
Format:
Order:
Sequence:
Gaps:
Download/view:

Download options

We make all of our alignments available in Stockholm format. You can download them here as raw, plain text files or as gzip-compressed files.

  Seed
(193)
Full
(2205)
Representative proteomes UniProt
(4275)
NCBI
(5379)
Meta
(424)
RP15
(604)
RP35
(1260)
RP55
(1762)
RP75
(2273)
Raw Stockholm Download   Download   Download   Download   Download   Download   Download   Download   Download  
Gzipped Download   Download   Download   Download   Download   Download   Download   Download   Download  

You can also download a FASTA format file containing the full-length sequences for all sequences in the full alignment.

HMM logo

HMM logos is one way of visualising profile HMMs. Logos provide a quick overview of the properties of an HMM in a graphical form. You can see a more detailed description of HMM logos and find out how you can interpret them here. More...

Trees

This page displays the phylogenetic tree for this family's seed alignment. We use FastTree to calculate neighbour join trees with a local bootstrap based on 100 resamples (shown next to the tree nodes). FastTree calculates approximately-maximum-likelihood phylogenetic trees from our seed alignment.

Note: You can also download the data file for the tree.

Curation and family details

This section shows the detailed information about the Pfam family. You can see the definitions of many of the terms in this section in the glossary and a fuller explanation of the scoring system that we use in the scores section of the help pages.

Curation View help on the curation process

Seed source: Pfam-B_1108 (release 3.0)
Previous IDs: none
Type: Family
Sequence Ontology: SO:0100021
Author: Finn RD , Bateman A
Number in seed: 193
Number in full: 2205
Average length of the domain: 400.30 aa
Average identity of full alignment: 40 %
Average coverage of the sequence by the domain: 40.16 %

HMM information View help on HMM parameters

HMM build commands:
build method: hmmbuild -o /dev/null HMM SEED
search method: hmmsearch -Z 47079205 -E 1000 --cpu 4 HMM pfamseq
Model details:
Parameter Sequence Domain
Gathering cut-off 22.0 22.0
Trusted cut-off 22.1 22.9
Noise cut-off 21.6 21.5
Model length: 426
Family (HMM) version: 20
Download: download the raw HMM for this family

Species distribution

Sunburst controls

Hide

Weight segments by...


Change the size of the sunburst

Small
Large

Colour assignments

Archea Archea Eukaryota Eukaryota
Bacteria Bacteria Other sequences Other sequences
Viruses Viruses Unclassified Unclassified
Viroids Viroids Unclassified sequence Unclassified sequence

Selections

Align selected sequences to HMM

Generate a FASTA-format file

Clear selection

This visualisation provides a simple graphical representation of the distribution of this family across species. You can find the original interactive tree in the adjacent tab. More...

Loading sunburst data...

Tree controls

Hide

The tree shows the occurrence of this domain across different species. More...

Loading...

Please note: for large trees this can take some time. While the tree is loading, you can safely switch away from this tab but if you browse away from the family page entirely, the tree will not be loaded.

Interactions

There are 4 interactions for this family. More...

RPOL_N RNA_pol RPOL_N Amidase_2

Structures

For those sequences which have a structure in the Protein DataBank, we use the mapping between UniProt, PDB and Pfam coordinate systems from the PDBe group, to allow us to map Pfam domains onto UniProt sequences and three-dimensional protein structures. The table below shows the structures on which the RNA_pol domain has been found. There are 33 instances of this domain found in the PDB. Note that there may be multiple copies of the domain in a single PDB structure, since many structures contain multiple copies of the same protein sequence.

Loading structure mapping...