Summary: Antitoxin component of bacterial toxin-antitoxin system, MqsA
Pfam includes annotations and additional family information from a range of different sources. These sources can be accessed via the tabs below.
This is the Wikipedia entry entitled "Toxin-antitoxin system". More...
Toxin-antitoxin system Edit Wikipedia article

A toxin-antitoxin system is a set of two or more closely linked genes that together encode both a "toxin" protein and a corresponding "antitoxin". Toxin-antitoxin systems are widely distributed in prokaryotes, and organisms often have them in multiple copies.[2][3] When these systems are contained on plasmids – transferable genetic elements – they ensure that only the daughter cells that inherit the plasmid survive after cell division. If the plasmid is absent in a daughter cell, the unstable antitoxin is degraded and the stable toxic protein kills the new cell; this is known as 'post-segregational killing' (PSK).[4][5]
Toxin-antitoxin systems are typically classified according to how the antitoxin neutralises the toxin. In a type I toxin-antitoxin system, the translation of messenger RNA (mRNA) that encodes the toxin is inhibited by the binding of a small non-coding RNA antitoxin that binds the toxin mRNA. The toxic protein in a type II system is inhibited post-translationally by the binding of an antitoxin protein. Type III toxin-antitoxin systems consist of a small RNA that binds directly to the toxin protein and inhibits its activity.[6] There are also types IV-VI, which are less common.[7] Toxin-antitoxin genes are often inherited through horizontal gene transfer[8][9] and are associated with pathogenic bacteria, having been found on plasmids conferring antibiotic resistance and virulence.[1]
Chromosomal toxin-antitoxin systems also exist, some of which are thought to perform cell functions such as responding to stresses, causing cell cycle arrest and bringing about programmed cell death.[1][10] In evolutionary terms, toxin-antitoxin systems can be considered selfish DNA in that the purpose of the systems are to replicate, regardless of whether they benefit the host organism or not. Some have proposed adaptive theories to explain the evolution of toxin-antitoxin systems; for example, chromosomal toxin-antitoxin systems could have evolved to prevent the inheritance of large deletions of the host genome.[11] Toxin-antitoxin systems have several biotechnological applications, such as maintaining plasmids in cell lines, targets for antibiotics, and as positive selection vectors.[12]
Contents
Biological functions
Stabilization and fitness of mobile DNA
As stated above, toxin-antitoxin systems are well characterized as plasmid addiction modules. It was also proposed that toxin-antitoxin systems have evolved as plasmid exclusion modules. A cell that would carry two plasmids from the same incompatibility group will eventually generate two daughters cells carrying either plasmid. Should one of these plasmids encode for a TA system, its "displacement" by another TA-free plasmid system will prevent its inheritance and thus induce post-segregetational killing.[13] This theory was corroborated through computer modelling.[14] Toxin-antitoxin systems can also be found on other mobile genetic elements such as conjugative transposons and temperate bacteriophages and could be implicated in the maintenance and competition of these elements.[15]
Genome stabilization

Toxin-antitoxin systems could prevent harmful large deletions in a bacterial genome, though arguably deletions of large coding regions are fatal to a daughter cell regardless.[11] In Vibrio cholerae, multiple type II toxin-antitoxin systems located in a super-integron were shown to prevent the loss of gene cassettes.[18]
Altruistic cell death
mazEF, a toxin-antitoxin locus found in E. coli and other bacteria, was proposed to induce programmed cell death in response to starvation, specifically a lack of amino acids.[19] This would release the cell's contents for absorption by neighbouring cells, potentially preventing the death of close relatives, and thereby increasing the inclusive fitness of the cell that perished. This would be an example of altruism and how bacterial colonies could resemble multicellular organisms.[14] However, the "mazEF-mediated PCD" has largely been refuted by several studies.[20][21][22]
Stress tolerance
Another theory states that chromosomal toxin-antitoxin systems are designed to be bacteriostatic rather than bactericidal.[23] RelE, for example, is a global inhibitor of translation, is induced during nutrient stress. By shutting down translation under stress, it could reduce the chance of starvation by lowering the cell's nutrient requirements.[24] However, it was shown that several toxin-antitoxin systems, including relBE, do not give any competitive advantage under any stress condition.[21]
Anti-addiction
It has been proposed that chromosomal homologues of plasmid toxin-antitoxin systems may serve as anti-addiction modules, which would allow progeny to lose a plasmid without suffering the effects of the toxin it encodes.[9] For example, a chromosomal copy of the ccdA antitoxin encoded in the chromosome of Erwinia chrysanthemi is able to neutralize the ccdB toxin encoded on the F plasmid and thus, prevent toxin activation when such a plasmid is lost.[25] Similarly, the ataR antitoxin encoded on the chromosome of E. coli O157:H7 is able neutralize the ataTP toxin encoded on plasmids found in other enterohemorragic E. coli.[26]
Phage protection
Type III toxin-antitoxin systems have been shown to protect bacteria from bacteriophages.[27][28] During an infection, bacteriophages hijack transcription and translation, which could prevent antitoxin replenishment and release toxin, triggering what is called an "abortive infection".[27][28] Similar protective effects have been observed with type I[29] and type II[30] toxin-antitoxin systems.
Antimicrobial persistence
When bacteria are challenged with antibiotics, a small and distinct subpopulation of cells is able to withstand the treatment by a phenomenon dubbed as "persistence" (not to be confused with resistance).[31] Due to their bacteriostatic properties, type II toxin-antitoxin systems have previously been thought to be responsible for persistence, by switching a fraction of the bacterial population to a dormant state.[32] However, this hypothesis has been widely invalidated.[33][34][35]
Selfish DNA
Toxin-antitoxin systems have been used as examples of selfish DNA as part of the gene centered view of evolution. It has been theorised that toxin-antitoxin loci serve only to maintain their own DNA, at the expense of the host organism.[1][36] Thus, chromosomal toxin-antitoxin systems would serve no purpose and could be treated as "junk DNA". For example, the ccdAB system encoded in the chromosome of E. coli O157:H7 has been shown to be under negative selection, albeit at a slow rate due to its addictive properties.[8]
System types
Type I

Type I toxin-antitoxin systems rely on the base-pairing of complementary antitoxin RNA with the toxin mRNA. Translation of the mRNA is then inhibited either by degradation via RNase III or by occluding the Shine-Dalgarno sequence or ribosome binding site of the toxin mRNA. Often the toxin and antitoxin are encoded on opposite strands of DNA. The 5' or 3' overlapping region between the two genes is the area involved in complementary base-pairing, usually with between 19–23 contiguous base pairs.[37]
Toxins of type I systems are small, hydrophobic proteins that confer toxicity by damaging cell membranes.[1] Few intracellular targets of type I toxins have been identified, possibly due to the difficult nature of analysing proteins that are poisonous to their bacterial hosts.[10]
Type I systems sometimes include a third component. In the case of the well-characterised hok/sok system, in addition to the hok toxin and sok antitoxin, there is a third gene, called mok. This open reading frame almost entirely overlaps that of the toxin, and the translation of the toxin is dependent on the translation of this third component.[5] Thus the binding of antitoxin to toxin is sometimes a simplification, and the antitoxin in fact binds a third RNA, which then affects toxin translation.[37]
Example systems
Toxin | Antitoxin | Notes | Ref. |
---|---|---|---|
hok | sok | The original and best-understood type I toxin-antitoxin system (pictured), which stabilises plasmids in a number of gram-negative bacteria | [37] |
fst | RNAII | The first type I system to be identified in gram-positive bacteria | [38] |
tisB | istR | A chromosomal system induced in the SOS response | [39] |
ldrD | rdlD | A chromosomal system in Enterobacteriaceae | [40] |
flmA | flmB | A hok/sok homologue, which also stabilises the F plasmid | [41] |
ibs | sib | Discovered in E. coli intergenic regions, the antitoxin was originally named QUAD RNA | [42] |
txpA/brnT | ratA | Ensures the inheritance of the skin element during sporulation in Bacillus subtilis | [43] |
symE | symR | A chromosomal system induced in the SOS response | [3] |
XCV2162 | ptaRNA1 | A system identified in Xanthomonas campestris with erratic phylogenetic distribution. | [44] |
sprA1 | sprA1as |
Type II

Type II toxin-antitoxin systems are generally better-understood than type I.[37] In this system a labile proteic antitoxin tightly binds and inhibits the activity of a stable toxin.[10] The largest family of type II toxin-antitoxin systems is vapBC,[45] which has been found through bioinformatics searches to represent between 37 and 42% of all predicted type II loci.[16][17]Type II systems are organised in operons with the antitoxin protein typically being located upstream of the toxin, which helps to prevent expression of the toxin without the antitoxin.[46] The proteins are typically around 100 amino acids in length,[37] and exhibit toxicity in a number of ways: CcdB, for example, affects DNA replication by poisoning DNA gyrase[47] whereas the MazF and RelE toxins are endoribonuclease that cleaves cellular mRNAs at specific sequence motifs.[48][24] The most common toxic activity is the protein acting as an endonuclease, also known as an interferase.[49][50]
A third protein can sometimes be involved in type II toxin-antitoxin systems. in the case of the ω-ε-ζ (omega-epsilon-zeta) system, the omega protein is a DNA binding protein that negatively regulates the transcription of the whole system.[51] Similarly, the paaR2 protein regulates the expression of the paaR2-paaA2-parE2 toxin-antitoxin system.[52] Other toxin-antitoxin systems can be found with a chaperone as a third component.[53] This chaperone is essential for proper folding of the antitoxin, thus making the antitoxin addicted to its cognate chaperone.
Example systems
Toxin | Antitoxin | Notes | Ref. |
---|---|---|---|
ccdB | ccdA | Found on the F plasmid of Escherichia coli | [47] |
parE | parD | Found in multiple copies in Caulobacter crescentus | [54] |
mazF | mazE | Found in E. coli and in chromosomes of other bacteria | [29] |
yafO | yafN | A system induced by the SOS response to DNA damage in E. coli | [55] |
hicA | hicB | Found in archaea and bacteria | [56] |
kid | kis | Stabilises the R1 plasmid and is related to the CcdB/A system | [23] |
ζ | ε | Found mostly in Gram-positive bacteria | [51] |
ataT | ataR | Found in enterohemorragic E. coli and Klebsiella spp. | [57] |
Type III
ToxN_toxin | |||||||||
---|---|---|---|---|---|---|---|---|---|
Identifiers | |||||||||
Symbol | ToxN, type III toxin-antitoxin system | ||||||||
Pfam | PF13958 | ||||||||
|
Type III toxin-antitoxin systems rely on direct interaction between a toxic protein and an RNA antitoxin. The toxic effects of the protein are neutralised by the RNA gene.[6] One example is the ToxIN system from the bacterial plant pathogen Erwinia carotovora. The toxic ToxN protein is approximately 170 amino acids long and has been shown to be toxic to E. coli. The toxic activity of ToxN is inhibited by ToxI RNA, an RNA with 5.5 direct repeats of a 36 nucleotide motif (AGGTGATTTGCTACCTTTAAGTGCAGCTAGAAATTC).[27][58] Crystallographic analysis of ToxIN has found that ToxN inhibition requires the formation of a trimeric ToxIN complex, whereby three ToxI monomers bind three ToxN monomers; the complex is held together by extensive protein-RNA interactions.[59]
Type IV
Type IV toxin-antitoxin systems are similar to type II systems, because they consist of two proteins. Unlike type II systems, the antitoxin in type IV toxin-antitoxin systems counteracts the activity of the toxin, and the two proteins do not directly interact.[60][61]
Type V
ghoST is a type V toxin-antitoxin system, in which the antitoxin (GhoS) cleaves the ghoT mRNA. This system is regulated by a type II system, mqsRA.[62]
Type VI
socAB is a type VI toxin-antitoxin system that was discovered in Caulobacter crescentus. The antitoxin, SocA, promotes degradation of the toxin, SocB, by the protease ClpXP.[63]
Biotechnological applications
The biotechnological applications of toxin-antitoxin systems have begun to be realised by several biotechnology organisations.[12][23] A primary usage is in maintaining plasmids in a large bacterial cell culture. In an experiment examining the effectiveness of the hok/sok locus, it was found that segregational stability of an inserted plasmid expressing beta-galactosidase was increased by between 8 and 22 times compared to a control culture lacking a toxin-antitoxin system.[64][65] In large-scale microorganism processes such as fermentation, progeny cells lacking the plasmid insert often have a higher fitness than those who inherit the plasmid and can outcompete the desirable microorganisms. A toxin-antitoxin system maintains the plasmid thereby maintaining the efficiency of the industrial process.[12]
Additionally, toxin-antitoxin systems may be a future target for antibiotics. Inducing suicide modules against pathogens could help combat the growing problem of multi-drug resistance.[66]
Ensuring a plasmid accepts an insert is a common problem of DNA cloning. Toxin-antitoxin systems can be used to positively select for only those cells that have taken up a plasmid containing the inserted gene of interest, screening out those that lack the inserted gene. An example of this application comes from the ccdB-encoded toxin, which has been incorporated into plasmid vectors.[67] The gene of interest is then targeted to recombine into the ccdB locus, inactivating the transcription of the toxic protein. Thus, cells containing the plasmid but not the insert perish due to the toxic effects of CcdB protein, and only those that incorporate the insert survive.[12]
Another example application involves both the CcdB toxin and CcdA antitoxin. CcdB is found in recombinant bacterial genomes and an inactivated version of CcdA is inserted into a linearised plasmid vector. A short extra sequence is added to the gene of interest that activates the antitoxin when the insertion occurs. This method ensures orientation-specific gene insertion.[67]
Genetically modified organisms must be contained in a pre-defined area during research.[66] Toxin-antitoxin systems can cause cell suicide in certain conditions, such as a lack of a lab-specific growth medium they would not encounter outside of the controlled laboratory set-up.[23][68]
See also
References
- ^ a b c d e Van Melderen L, Saavedra De Bast M (March 2009). Rosenberg SM (ed.). "Bacterial toxin-antitoxin systems: more than selfish entities?". PLoS Genetics. 5 (3): e1000437. doi:10.1371/journal.pgen.1000437. PMC 2654758. PMID 19325885.
- ^ Fozo EM, Makarova KS, Shabalina SA, Yutin N, Koonin EV, Storz G (June 2010). "Abundance of type I toxin-antitoxin systems in bacteria: searches for new candidates and discovery of novel families". Nucleic Acids Research. 38 (11): 3743–59. doi:10.1093/nar/gkq054. PMC 2887945. PMID 20156992.
- ^ a b Gerdes K, Wagner EG (April 2007). "RNA antitoxins". Current Opinion in Microbiology. 10 (2): 117–24. doi:10.1016/j.mib.2007.03.003. PMID 17376733.
- ^ Gerdes K (February 2000). "Toxin-antitoxin modules may regulate synthesis of macromolecules during nutritional stress". Journal of Bacteriology. 182 (3): 561–72. doi:10.1128/JB.182.3.561-572.2000. PMC 94316. PMID 10633087.
- ^ a b Faridani OR, Nikravesh A, Pandey DP, Gerdes K, Good L (2006). "Competitive inhibition of natural antisense Sok-RNA interactions activates Hok-mediated cell killing in Escherichia coli". Nucleic Acids Research. 34 (20): 5915–22. doi:10.1093/nar/gkl750. PMC 1635323. PMID 17065468.
- ^ a b Labrie SJ, Samson JE, Moineau S (May 2010). "Bacteriophage resistance mechanisms". Nature Reviews. Microbiology. 8 (5): 317–27. doi:10.1038/nrmicro2315. PMID 20348932.
- ^ Page R, Peti W (April 2016). "Toxin-antitoxin systems in bacterial growth arrest and persistence". Nature Chemical Biology. 12 (4): 208–14. doi:10.1038/nchembio.2044. PMID 26991085.
- ^ a b Mine N, Guglielmini J, Wilbaux M, Van Melderen L (April 2009). "The decay of the chromosomally encoded ccdO157 toxin-antitoxin system in the Escherichia coli species". Genetics. 181 (4): 1557–66. doi:10.1534/genetics.108.095190. PMC 2666520. PMID 19189956.
- ^ a b Ramisetty BC, Santhosh RS (February 2016). "Horizontal gene transfer of chromosomal Type II toxin-antitoxin systems of Escherichia coli". FEMS Microbiology Letters. 363 (3): fnv238. doi:10.1093/femsle/fnv238. PMID 26667220.
- ^ a b c Hayes F (September 2003). "Toxins-antitoxins: plasmid maintenance, programmed cell death, and cell cycle arrest". Science. 301 (5639): 1496–9. doi:10.1126/science.1088157. PMID 12970556.
- ^ a b Rowe-Magnus DA, Guerout AM, Biskri L, Bouige P, Mazel D (March 2003). "Comparative analysis of superintegrons: engineering extensive genetic diversity in the Vibrionaceae". Genome Research. 13 (3): 428–42. doi:10.1101/gr.617103. PMC 430272. PMID 12618374.
- ^ a b c d Stieber D, Gabant P, Szpirer C (September 2008). "The art of selective killing: plasmid toxin/antitoxin systems and their technological applications". BioTechniques. 45 (3): 344–6. doi:10.2144/000112955. PMID 18778262.
- ^ Cooper TF, Heinemann JA (November 2000). "Postsegregational killing does not increase plasmid stability but acts to mediate the exclusion of competing plasmids". Proceedings of the National Academy of Sciences of the United States of America. 97 (23): 12643–8. doi:10.1073/pnas.220077897. PMC 18817. PMID 11058151.
- ^ a b Mochizuki A, Yahara K, Kobayashi I, Iwasa Y (February 2006). "Genetic addiction: selfish gene's strategy for symbiosis in the genome". Genetics. 172 (2): 1309–23. doi:10.1534/genetics.105.042895. PMC 1456228. PMID 16299387.
- ^ Magnuson RD (September 2007). "Hypothetical functions of toxin-antitoxin systems". Journal of Bacteriology. 189 (17): 6089–92. doi:10.1128/JB.00958-07. PMC 1951896. PMID 17616596.
- ^ a b Pandey DP, Gerdes K (2005). "Toxin-antitoxin loci are highly abundant in free-living but lost from host-associated prokaryotes". Nucleic Acids Research. 33 (3): 966–76. doi:10.1093/nar/gki201. PMC 549392. PMID 15718296.
- ^ a b c Sevin EW, Barloy-Hubler F (2007). "RASTA-Bacteria: a web-based tool for identifying toxin-antitoxin loci in prokaryotes". Genome Biology. 8 (8): R155. doi:10.1186/gb-2007-8-8-r155. PMC 2374986. PMID 17678530.
- ^ Szekeres S, Dauti M, Wilde C, Mazel D, Rowe-Magnus DA (March 2007). "Chromosomal toxin-antitoxin loci can diminish large-scale genome reductions in the absence of selection". Molecular Microbiology. 63 (6): 1588–605. doi:10.1111/j.1365-2958.2007.05613.x. PMID 17367382.
- ^ Aizenman E, Engelberg-Kulka H, Glaser G (June 1996). "An Escherichia coli chromosomal "addiction module" regulated by guanosine [corrected] 3',5'-bispyrophosphate: a model for programmed bacterial cell death". Proceedings of the National Academy of Sciences of the United States of America. 93 (12): 6059–63. doi:10.1073/pnas.93.12.6059. PMC 39188. PMID 8650219.
- ^ Ramisetty BC, Natarajan B, Santhosh RS (February 2015). "mazEF-mediated programmed cell death in bacteria: "what is this?"". Critical Reviews in Microbiology. 41 (1): 89–100. doi:10.3109/1040841X.2013.804030. PMID 23799870.
- ^ a b Tsilibaris V, Maenhaut-Michel G, Mine N, Van Melderen L (September 2007). "What is the benefit to Escherichia coli of having multiple toxin-antitoxin systems in its genome?". Journal of Bacteriology. 189 (17): 6101–8. doi:10.1128/JB.00527-07. PMC 1951899. PMID 17513477.
- ^ Ramisetty BC, Raj S, Ghosh D (December 2016). "Escherichia coli MazEF toxin-antitoxin system does not mediate programmed cell death". Journal of Basic Microbiology. 56 (12): 1398–1402. doi:10.1002/jobm.201600247. PMID 27259116.
- ^ a b c d Diago-Navarro E, Hernandez-Arriaga AM, López-Villarejo J, Muñoz-Gómez AJ, Kamphuis MB, Boelens R, Lemonnier M, DÃaz-Orejas R (August 2010). "parD toxin-antitoxin system of plasmid R1--basic contributions, biotechnological applications and relationships with closely-related toxin-antitoxin systems". The FEBS Journal. 277 (15): 3097–117. doi:10.1111/j.1742-4658.2010.07722.x. PMID 20569269.
- ^ a b Christensen SK, Mikkelsen M, Pedersen K, Gerdes K (December 2001). "RelE, a global inhibitor of translation, is activated during nutritional stress". Proceedings of the National Academy of Sciences of the United States of America. 98 (25): 14328–33. doi:10.1073/pnas.251327898. PMC 64681. PMID 11717402.
- ^ Saavedra De Bast M, Mine N, Van Melderen L (July 2008). "Chromosomal toxin-antitoxin systems may act as antiaddiction modules". Journal of Bacteriology. 190 (13): 4603–9. doi:10.1128/JB.00357-08. PMC 2446810. PMID 18441063.
- ^ Jurėnas, Dukas; Garcia-Pino, Abel; Van Melderen, Laurence (2017-09-01). "Novel toxins from type II toxin-antitoxin systems with acetyltransferase activity". Plasmid. 93: 30–35. doi:10.1016/j.plasmid.2017.08.005. ISSN 0147-619X. PMID 28941941.
- ^ a b c Fineran PC, Blower TR, Foulds IJ, Humphreys DP, Lilley KS, Salmond GP (January 2009). "The phage abortive infection system, ToxIN, functions as a protein-RNA toxin-antitoxin pair". Proceedings of the National Academy of Sciences of the United States of America. 106 (3): 894–9. doi:10.1073/pnas.0808832106. PMC 2630095. PMID 19124776.
- ^ a b Emond E, Dion E, Walker SA, Vedamuthu ER, Kondo JK, Moineau S (December 1998). "AbiQ, an abortive infection mechanism from Lactococcus lactis". Applied and Environmental Microbiology. 64 (12): 4748–56. PMC 90918. PMID 9835558.
- ^ a b Hazan R, Engelberg-Kulka H (September 2004). "Escherichia coli mazEF-mediated cell death as a defense mechanism that inhibits the spread of phage P1". Molecular Genetics and Genomics. 272 (2): 227–34. doi:10.1007/s00438-004-1048-y. PMID 15316771.
- ^ Pecota DC, Wood TK (April 1996). "Exclusion of T4 phage by the hok/sok killer locus from plasmid R1". Journal of Bacteriology. 178 (7): 2044–50. doi:10.1128/jb.178.7.2044-2050.1996. PMC 177903. PMID 8606182.
- ^ Kussell E, Kishony R, Balaban NQ, Leibler S (April 2005). "Bacterial persistence: a model of survival in changing environments". Genetics. 169 (4): 1807–14. doi:10.1534/genetics.104.035352. PMC 1449587. PMID 15687275.
- ^ Maisonneuve E, Gerdes K (April 2014). "Molecular mechanisms underlying bacterial persisters". Cell. 157 (3): 539–48. doi:10.1016/j.cell.2014.02.050. PMID 24766804.
- ^ Ramisetty BC, Ghosh D, Roy Chowdhury M, Santhosh RS (2016). "What Is the Link between Stringent Response, Endoribonuclease Encoding Type II Toxin-Antitoxin Systems and Persistence?". Frontiers in Microbiology. 7: 1882. doi:10.3389/fmicb.2016.01882. PMC 5120126. PMID 27933045.
- ^ Harms A, Fino C, Sørensen MA, Semsey S, Gerdes K (December 2017). "Prophages and Growth Dynamics Confound Experimental Results with Antibiotic-Tolerant Persister Cells". mBio. 8 (6): e01964–17. doi:10.1128/mBio.01964-17. PMC 5727415. PMID 29233898.
- ^ Goormaghtigh F, Fraikin N, Putrinš M, Hallaert T, Hauryliuk V, Garcia-Pino A, Sjödin A, Kasvandik S, Udekwu K, Tenson T, Kaldalu N, Van Melderen L (June 2018). "Reassessing the Role of Type II Toxin-Antitoxin Systems in Formation of Escherichia coli Type II Persister Cells". mBio. 9 (3): e00640–18. doi:10.1128/mBio.00640-18. PMC 6016239. PMID 29895634.
- ^ Ramisetty BC, Santhosh RS (July 2017). "Endoribonuclease type II toxin-antitoxin systems: functional or selfish?". Microbiology. 163 (7): 931–939. doi:10.1099/mic.0.000487. PMID 28691660.
- ^ a b c d e Fozo EM, Hemm MR, Storz G (December 2008). "Small toxic proteins and the antisense RNAs that repress them". Microbiology and Molecular Biology Reviews. 72 (4): 579–89, Table of Contents. doi:10.1128/MMBR.00025-08. PMC 2593563. PMID 19052321.
- ^ Greenfield TJ, Ehli E, Kirshenmann T, Franch T, Gerdes K, Weaver KE (August 2000). "The antisense RNA of the par locus of pAD1 regulates the expression of a 33-amino-acid toxic peptide by an unusual mechanism". Molecular Microbiology. 37 (3): 652–60. doi:10.1046/j.1365-2958.2000.02035.x. PMID 10931358. (subscription required)
- ^ Vogel J, Argaman L, Wagner EG, Altuvia S (December 2004). "The small RNA IstR inhibits synthesis of an SOS-induced toxic peptide". Current Biology. 14 (24): 2271–6. doi:10.1016/j.cub.2004.12.003. PMID 15620655.
- ^ Kawano M, Oshima T, Kasai H, Mori H (July 2002). "Molecular characterization of long direct repeat (LDR) sequences expressing a stable mRNA encoding for a 35-amino-acid cell-killing peptide and a cis-encoded small antisense RNA in Escherichia coli". Molecular Microbiology. 45 (2): 333–49. doi:10.1046/j.1365-2958.2002.03042.x. PMID 12123448. (subscription required)
- ^ Loh SM, Cram DS, Skurray RA (June 1988). "Nucleotide sequence and transcriptional analysis of a third function (Flm) involved in F-plasmid maintenance". Gene. 66 (2): 259–68. doi:10.1016/0378-1119(88)90362-9. PMID 3049248.
- ^ Fozo EM, Kawano M, Fontaine F, Kaya Y, Mendieta KS, Jones KL, Ocampo A, Rudd KE, Storz G (December 2008). "Repression of small toxic protein synthesis by the Sib and OhsC small RNAs". Molecular Microbiology. 70 (5): 1076–93. doi:10.1111/j.1365-2958.2008.06394.x. PMC 2597788. PMID 18710431. (subscription required)
- ^ Silvaggi JM, Perkins JB, Losick R (October 2005). "Small untranslated RNA antitoxin in Bacillus subtilis". Journal of Bacteriology. 187 (19): 6641–50. doi:10.1128/JB.187.19.6641-6650.2005. PMC 1251590. PMID 16166525.
- ^ Findeiss S, Schmidtke C, Stadler PF, Bonas U (March 2010). "A novel family of plasmid-transferred anti-sense ncRNAs". RNA Biology. 7 (2): 120–4. doi:10.4161/rna.7.2.11184. PMID 20220307.
- ^ Robson J, McKenzie JL, Cursons R, Cook GM, Arcus VL (July 2009). "The vapBC operon from Mycobacterium smegmatis is an autoregulated toxin-antitoxin module that controls growth via inhibition of translation". Journal of Molecular Biology. 390 (3): 353–67. doi:10.1016/j.jmb.2009.05.006. PMID 19445953.
- ^ Deter HS, Jensen RV, Mather WH, Butzin NC (July 2017). "Mechanisms for Differential Protein Production in Toxin-Antitoxin Systems". Toxins. 9 (7): 211. doi:10.3390/toxins9070211. PMC 5535158. PMID 28677629.
- ^ a b Bernard P, Couturier M (August 1992). "Cell killing by the F plasmid CcdB protein involves poisoning of DNA-topoisomerase II complexes" (PDF). Journal of Molecular Biology. 226 (3): 735–45. doi:10.1016/0022-2836(92)90629-X. PMID 1324324.
- ^ Zhang Y, Zhang J, Hoeflich KP, Ikura M, Qing G, Inouye M (October 2003). "MazF cleaves cellular mRNAs specifically at ACA to block protein synthesis in Escherichia coli". Molecular Cell. 12 (4): 913–23. doi:10.1016/S1097-2765(03)00402-7. PMID 14580342.
- ^ Christensen-Dalsgaard M, Overgaard M, Winther KS, Gerdes K (2008). RNA decay by messenger RNA interferases. Methods in Enzymology. 447. pp. 521–35. doi:10.1016/S0076-6879(08)02225-8. ISBN 978-0-12-374377-0. PMID 19161859.
- ^ Yamaguchi Y, Inouye M (2009). mRNA interferases, sequence-specific endoribonucleases from the toxin-antitoxin systems. Progress in Molecular Biology and Translational Science. 85. pp. 467–500. doi:10.1016/S0079-6603(08)00812-X. ISBN 978-0-12-374761-7. PMID 19215780.
- ^ a b Mutschler H, Meinhart A (December 2011). "ε/ζ systems: their role in resistance, virulence, and their potential for antibiotic development". Journal of Molecular Medicine. 89 (12): 1183–94. doi:10.1007/s00109-011-0797-4. PMC 3218275. PMID 21822621.
- ^ Hallez R, Geeraerts D, Sterckx Y, Mine N, Loris R, Van Melderen L (May 2010). "New toxins homologous to ParE belonging to three-component toxin-antitoxin systems in Escherichia coli O157:H7". Molecular Microbiology. 76 (3): 719–32. doi:10.1111/j.1365-2958.2010.07129.x. PMID 20345661.
- ^ Bordes P, Cirinesi AM, Ummels R, Sala A, Sakr S, Bitter W, Genevaux P (May 2011). "SecB-like chaperone controls a toxin-antitoxin stress-responsive system in Mycobacterium tuberculosis". Proceedings of the National Academy of Sciences of the United States of America. 108 (20): 8438–43. doi:10.1073/pnas.1101189108. PMC 3100995. PMID 21536872.
- ^ Fiebig A, Castro Rojas CM, Siegal-Gaskins D, Crosson S (July 2010). "Interaction specificity, toxicity and regulation of a paralogous set of ParE/RelE-family toxin-antitoxin systems". Molecular Microbiology. 77 (1): 236–51. doi:10.1111/j.1365-2958.2010.07207.x. PMC 2907451. PMID 20487277. (subscription required)
- ^ Singletary LA, Gibson JL, Tanner EJ, McKenzie GJ, Lee PL, Gonzalez C, Rosenberg SM (December 2009). "An SOS-regulated type 2 toxin-antitoxin system". Journal of Bacteriology. 191 (24): 7456–65. doi:10.1128/JB.00963-09. PMC 2786605. PMID 19837801.
- ^ Jørgensen MG, Pandey DP, Jaskolska M, Gerdes K (February 2009). "HicA of Escherichia coli defines a novel family of translation-independent mRNA interferases in bacteria and archaea". Journal of Bacteriology. 191 (4): 1191–9. doi:10.1128/JB.01013-08. PMC 2631989. PMID 19060138.
- ^ Jurėnas D, Chatterjee S, Konijnenberg A, Sobott F, Droogmans L, Garcia-Pino A, Van Melderen L (June 2017). "fMet" (PDF). Nature Chemical Biology. 13 (6): 640–646. doi:10.1038/nchembio.2346. PMID 28369041.
- ^ Blower TR, Fineran PC, Johnson MJ, Toth IK, Humphreys DP, Salmond GP (October 2009). "Mutagenesis and functional characterization of the RNA and protein components of the toxIN abortive infection and toxin-antitoxin locus of Erwinia". Journal of Bacteriology. 191 (19): 6029–39. doi:10.1128/JB.00720-09. PMC 2747886. PMID 19633081.
- ^ Blower TR, Pei XY, Short FL, Fineran PC, Humphreys DP, Luisi BF, Salmond GP (February 2011). "A processed noncoding RNA regulates an altruistic bacterial antiviral system". Nature Structural & Molecular Biology. 18 (2): 185–90. doi:10.1038/nsmb.1981. PMC 4612426. PMID 21240270.
- ^ Brown JM, Shaw KJ (November 2003). "A novel family of Escherichia coli toxin-antitoxin gene pairs". Journal of Bacteriology. 185 (22): 6600–8. doi:10.1128/jb.185.22.6600-6608.2003. PMC 262102. PMID 14594833.
- ^ Jankevicius G, Ariza A, Ahel M, Ahel I (December 2016). "The Toxin-Antitoxin System DarTG Catalyzes Reversible ADP-Ribosylation of DNA". Molecular Cell. 64 (6): 1109–1116. doi:10.1016/j.molcel.2016.11.014. PMC 5179494. PMID 27939941.
- ^ Wang X, Lord DM, Hong SH, Peti W, Benedik MJ, Page R, Wood TK (June 2013). "Type II toxin/antitoxin MqsR/MqsA controls type V toxin/antitoxin GhoT/GhoS". Environmental Microbiology. 15 (6): 1734–44. doi:10.1111/1462-2920.12063. PMC 3620836. PMID 23289863.
- ^ Aakre CD, Phung TN, Huang D, Laub MT (December 2013). "A bacterial toxin inhibits DNA replication elongation through a direct interaction with the β sliding clamp". Molecular Cell. 52 (5): 617–28. doi:10.1016/j.molcel.2013.10.014. PMC 3918436. PMID 24239291.
- ^ Wu K, Jahng D, Wood TK (1994). "Temperature and growth rate effects on the hok/sok killer locus for enhanced plasmid stability". Biotechnology Progress. 10 (6): 621–9. doi:10.1021/bp00030a600. PMID 7765697.
- ^ Pecota DC, Kim CS, Wu K, Gerdes K, Wood TK (May 1997). "Combining the hok/sok, parDE, and pnd postsegregational killer loci to enhance plasmid stability". Applied and Environmental Microbiology. 63 (5): 1917–24. PMC 168483. PMID 9143123.
- ^ a b Gerdes K, Christensen SK, Løbner-Olesen A (May 2005). "Prokaryotic toxin-antitoxin stress response loci". Nature Reviews. Microbiology. 3 (5): 371–82. doi:10.1038/nrmicro1147. PMID 15864262.
- ^ a b Bernard P, Gabant P, Bahassi EM, Couturier M (October 1994). "Positive-selection vectors using the F plasmid ccdB killer gene". Gene. 148 (1): 71–4. doi:10.1016/0378-1119(94)90235-6. PMID 7926841.
- ^ Torres B, Jaenecke S, Timmis KN, GarcÃa JL, DÃaz E (December 2003). "A dual lethal system to enhance containment of recombinant micro-organisms". Microbiology. 149 (Pt 12): 3595–601. doi:10.1099/mic.0.26618-0. PMID 14663091.
External links
- RASTA – Rapid Automated Scan for Toxins and Antitoxins in Bacteria
This page is based on a Wikipedia article. The text is available under the Creative Commons Attribution/Share-Alike License.
This tab holds the annotation information that is stored in the Pfam database. As we move to using Wikipedia as our main source of annotation, the contents of this tab will be gradually replaced by the Wikipedia tab.
Antitoxin component of bacterial toxin-antitoxin system, MqsA Provide feedback
MqsA_antitoxin is a family of prokaryotic proteins that act as antidotes to the mRNA interferase MqsR. It has a zinc-binding at the very N-terminus indicating its DNA-binding capacity. MqsR is the gene most highly upregulated in E. Colo MqsR_toxin is a family of bacterial toxins that act as an mRNA interferase. MqsR is the gene most highly upregulated in E. coli persister cells [2] and it plays an essential role in biofilm regulation [3] and cell signalling [4]. It forms part of a bacterial toxin-antitoxin TA system, and as expected for a TA system, the expression of the MqsR toxin leads to growth arrest, while co-expression with its antitoxin, MqsA, rescues the growth arrest phenotype. In addition, MqsR associates with MqsA to form a tight, non-toxic complex and both MqsA alone and the MqsR:MqsA2 complex bind and regulate the mqsR promoter. The structure of MqsR shows that is is a member of the RelE/YoeB family of bacterial RNases that are structurally and functionally characterised bacterial toxins [1].
Literature references
-
Brown BL, Grigoriu S, Kim Y, Arruda JM, Davenport A, Wood TK, Peti W, Page R;, PLoS Pathog. 2009;5:e1000706.: Three dimensional structure of the MqsR:MqsA complex: a novel TA pair comprised of a toxin homologous to RelE and an antitoxin with unique properties. PUBMED:20041169 EPMC:20041169
-
Shah D, Zhang Z, Khodursky A, Kaldalu N, Kurg K, Lewis K;, BMC Microbiol. 2006;6:53.: Persisters: a distinct physiological state of E. coli. PUBMED:16768798 EPMC:16768798
-
Gonzalez Barrios AF, Zuo R, Hashimoto Y, Yang L, Bentley WE, Wood TK;, J Bacteriol. 2006;188:305-316.: Autoinducer 2 controls biofilm formation in Escherichia coli through a novel motility quorum-sensing regulator (MqsR, B3022). PUBMED:16352847 EPMC:16352847
-
Ren D, Bedzyk LA, Thomas SM, Ye RW, Wood TK;, Appl Microbiol Biotechnol. 2004;64:515-524.: Gene expression in Escherichia coli biofilms. PUBMED:14727089 EPMC:14727089
Internal database links
SCOOP: | BetR HTH_11 HTH_19 HTH_23 HTH_24 HTH_25 HTH_26 HTH_28 HTH_3 HTH_31 HTH_37 HTH_Crp_2 Phage_CI_repr Sigma70_r4 YdaS_antitoxin YokU |
Similarity to PfamA using HHSearch: | HTH_3 HTH_19 HTH_31 |
This tab holds annotation information from the InterPro database.
InterPro entry IPR032758
This is a family of prokaryotic proteins that are the antitoxin components of the toxin-antitoxin (TA) modules. Proteins in this entry include MqsA from Escherichia coli and HigA-2 from Vibrio cholerae serotype O1. MqsA acts as antidote to the mRNA interferase MqsR [PUBMED:24212724], while HigA-2 counteracts the effect of the HigB-2 toxin [PUBMED:17020579].
MqsA has a zinc-binding at the very N terminus indicating its DNA-binding capacity. MqsR is a family of bacterial toxins that act as an mRNA interferase. The mqsR gene is the gene most highly upregulated in E. coli persister cells [PUBMED:16768798] and the MgsR protein plays an essential role in biofilm regulation [PUBMED:16352847] and cell signalling [PUBMED:14727089]. It forms part of a bacterial toxin-antitoxin TA system, and as expected for a TA system, the expression of the MqsR toxin leads to growth arrest, while co-expression with its antitoxin, MqsA, rescues the growth arrest phenotype. In addition, MqsR associates with MqsA to form a tight, non-toxic complex and both MqsA alone and the MqsR:MqsA2:MqsR complex bind and regulate the mqsR promoter. The structure of MqsR shows that is is a member of the RelE/YoeB family of bacterial RNases that are structurally and functionally characterised bacterial toxins [PUBMED:20041169].
Domain organisation
Below is a listing of the unique domain organisations or architectures in which this domain is found. More...
Loading domain graphics...
Pfam Clan
This family is a member of clan HTH (CL0123), which has the following description:
This family contains a diverse range of mostly DNA-binding domains that contain a helix-turn-helix motif.
The clan contains the following 341 members:
AbiEi_3_N AbiEi_4 ANAPC2 AphA_like Arg_repressor ARID ArsR B-block_TFIIIC B5 Bac_DnaA_C Baculo_PEP_N BetR BHD_3 BLACT_WH Bot1p BrkDBD BsuBI_PstI_RE_N C_LFY_FLO CaiF_GrlA CarD_CdnL_TRCF CDC27 Cdc6_C Cdh1_DBD_1 CDT1 CDT1_C CENP-B_N Costars CPSase_L_D3 Cro Crp CSN4_RPN5_eIF3a CSN8_PSD8_EIF3K CtsR Cullin_Nedd8 CUT CUTL CvfB_WH DBD_HTH DDRGK DEP Dimerisation Dimerisation2 DNA_meth_N DpnI_C DprA_WH DsrC DsrD DUF1016_N DUF1133 DUF1153 DUF1323 DUF134 DUF1441 DUF1492 DUF1495 DUF1670 DUF1804 DUF1819 DUF1836 DUF1870 DUF2089 DUF2250 DUF2316 DUF2513 DUF2582 DUF3116 DUF3253 DUF3853 DUF3860 DUF3908 DUF433 DUF4364 DUF4423 DUF4447 DUF480 DUF4817 DUF5635 DUF573 DUF722 DUF739 DUF742 DUF977 E2F_TDP EAP30 eIF-5_eIF-2B ELL ESCRT-II Ets EutK_C Exc F-112 FaeA Fe_dep_repr_C Fe_dep_repress FeoC FokI_C FokI_N Forkhead FtsK_gamma FUR GcrA GerE GntR GP3_package HARE-HTH HemN_C HNF-1_N Homeobox_KN Homeodomain Homez HPD HrcA_DNA-bdg HSF_DNA-bind HTH_1 HTH_10 HTH_11 HTH_12 HTH_13 HTH_15 HTH_16 HTH_17 HTH_18 HTH_19 HTH_20 HTH_21 HTH_22 HTH_23 HTH_24 HTH_25 HTH_26 HTH_27 HTH_28 HTH_29 HTH_3 HTH_30 HTH_31 HTH_32 HTH_33 HTH_34 HTH_35 HTH_36 HTH_37 HTH_38 HTH_39 HTH_40 HTH_41 HTH_42 HTH_43 HTH_45 HTH_46 HTH_47 HTH_48 HTH_49 HTH_5 HTH_50 HTH_51 HTH_52 HTH_53 HTH_54 HTH_55 HTH_56 HTH_57 HTH_6 HTH_7 HTH_8 HTH_9 HTH_ABP1_N HTH_AraC HTH_AsnC-type HTH_CodY HTH_Crp_2 HTH_DeoR HTH_IclR HTH_Mga HTH_micro HTH_OrfB_IS605 HTH_PafC HTH_ParB HTH_psq HTH_SUN2 HTH_Tnp_1 HTH_Tnp_1_2 HTH_Tnp_4 HTH_Tnp_IS1 HTH_Tnp_IS630 HTH_Tnp_ISL3 HTH_Tnp_Mu_1 HTH_Tnp_Mu_2 HTH_Tnp_Tc3_1 HTH_Tnp_Tc3_2 HTH_Tnp_Tc5 HTH_WhiA HxlR IBD IF2_N IRF KicB KilA-N Kin17_mid KORA KorB La LacI LexA_DNA_bind Linker_histone LZ_Tnp_IS481 MADF_DNA_bdg MAGE MarR MarR_2 MerR MerR-DNA-bind MerR_1 MerR_2 Mga Mnd1 MogR_DNAbind Mor MotA_activ MqsA_antitoxin MRP-L20 MukE Myb_DNA-bind_2 Myb_DNA-bind_3 Myb_DNA-bind_4 Myb_DNA-bind_5 Myb_DNA-bind_6 Myb_DNA-bind_7 Myb_DNA-binding Neugrin NFRKB_winged NOD2_WH NUMOD1 ORC_WH_C OST-HTH P22_Cro PaaX PadR PapB PAX PCI Penicillinase_R Phage_AlpA Phage_antitermQ Phage_CI_repr Phage_CII Phage_NinH Phage_Nu1 Phage_rep_O Phage_rep_org_N Phage_terminase PheRS_DBD1 PheRS_DBD2 PheRS_DBD3 Pou Pox_D5 PqqD PRC2_HTH_1 PUFD PuR_N Put_DNA-bind_N Raf1_HTH Rap1-DNA-bind Rep_3 RepA_C RepA_N RepC RepL Replic_Relax RFX_DNA_binding Ribosomal_S18 Ribosomal_S19e Ribosomal_S25 Rio2_N RNA_pol_Rpc34 RNA_pol_Rpc82 RNase_H2-Ydr279 ROQ_II RP-C RPA RPA_C RQC Rrf2 RTP RuvB_C S10_plectin SAC3_GANP SANT_DAMP1_like SatD SelB-wing_1 SelB-wing_2 SelB-wing_3 SgrR_N Sigma54_CBD Sigma54_DBD Sigma70_ECF Sigma70_ner Sigma70_r2 Sigma70_r3 Sigma70_r4 Sigma70_r4_2 Ski_Sno SLIDE Slx4 SMC_Nse1 SMC_ScpB SoPB_HTH SpoIIID SRP19 SRP_SPB STN1_2 Sulfolobus_pRN Suv3_N Swi6_N SWIRM Tau95 TBPIP TEA Terminase_5 TetR_N TFA2_Winged_2 TFIIE_alpha TFIIE_beta TFIIF_alpha TFIIF_beta Tn7_Tnp_TnsA_C Tn916-Xis TraI_2_C Trans_reg_C TrfA TrmB tRNA_bind_2 tRNA_bind_3 Trp_repressor UPF0122 UPF0175 Vir_act_alpha_C YdaS_antitoxin YjcQ YokU z-alphaAlignments
We store a range of different sequence alignments for families. As well as the seed alignment from which the family is built, we provide the full alignment, generated by searching the sequence database (reference proteomes) using the family HMM. We also generate alignments using four representative proteomes (RP) sets, the UniProtKB sequence database, the NCBI sequence database, and our metagenomics sequence database. More...
View options
We make a range of alignments for each Pfam-A family. You can see a description of each above. You can view these alignments in various ways but please note that some types of alignment are never generated while others may not be available for all families, most commonly because the alignments are too large to handle.
Seed (10) |
Full (456) |
Representative proteomes | UniProt (2681) |
NCBI (4342) |
Meta (40) |
||||
---|---|---|---|---|---|---|---|---|---|
RP15 (63) |
RP35 (200) |
RP55 (381) |
RP75 (746) |
||||||
Jalview | |||||||||
HTML | |||||||||
PP/heatmap | 1 |
1Cannot generate PP/Heatmap alignments for seeds; no PP data available
Key:
available,
not generated,
— not available.
Format an alignment
Download options
We make all of our alignments available in Stockholm format. You can download them here as raw, plain text files or as gzip-compressed files.
Seed (10) |
Full (456) |
Representative proteomes | UniProt (2681) |
NCBI (4342) |
Meta (40) |
||||
---|---|---|---|---|---|---|---|---|---|
RP15 (63) |
RP35 (200) |
RP55 (381) |
RP75 (746) |
||||||
Raw Stockholm | |||||||||
Gzipped |
You can also download a FASTA format file containing the full-length sequences for all sequences in the full alignment.
HMM logo
HMM logos is one way of visualising profile HMMs. Logos provide a quick overview of the properties of an HMM in a graphical form. You can see a more detailed description of HMM logos and find out how you can interpret them here. More...
Trees
This page displays the phylogenetic tree for this family's seed alignment. We use FastTree to calculate neighbour join trees with a local bootstrap based on 100 resamples (shown next to the tree nodes). FastTree calculates approximately-maximum-likelihood phylogenetic trees from our seed alignment.
Note: You can also download the data file for the tree.
Curation and family details
This section shows the detailed information about the Pfam family. You can see the definitions of many of the terms in this section in the glossary and a fuller explanation of the scoring system that we use in the scores section of the help pages.
Curation
Seed source: | Jackhmmer:Q46864 |
Previous IDs: | none |
Type: | Domain |
Sequence Ontology: | SO:0000417 |
Author: |
Coggill P |
Number in seed: | 10 |
Number in full: | 456 |
Average length of the domain: | 111.80 aa |
Average identity of full alignment: | 23 % |
Average coverage of the sequence by the domain: | 71.45 % |
HMM information
HMM build commands: |
build method: hmmbuild -o /dev/null HMM SEED
search method: hmmsearch -Z 47079205 -E 1000 --cpu 4 HMM pfamseq
|
||||||||||||
Model details: |
|
||||||||||||
Model length: | 131 | ||||||||||||
Family (HMM) version: | 6 | ||||||||||||
Download: | download the raw HMM for this family |
Species distribution
Sunburst controls
HideWeight segments by...
Change the size of the sunburst
Colour assignments
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
Selections
Align selected sequences to HMM
Generate a FASTA-format file
Clear selection
This visualisation provides a simple graphical representation of the distribution of this family across species. You can find the original interactive tree in the adjacent tab. More...
Tree controls
HideThe tree shows the occurrence of this domain across different species. More...
Loading...
Please note: for large trees this can take some time. While the tree is loading, you can safely switch away from this tab but if you browse away from the family page entirely, the tree will not be loaded.
Structures
For those sequences which have a structure in the Protein DataBank, we use the mapping between UniProt, PDB and Pfam coordinate systems from the PDBe group, to allow us to map Pfam domains onto UniProt sequences and three-dimensional protein structures. The table below shows the structures on which the MqsA_antitoxin domain has been found. There are 19 instances of this domain found in the PDB. Note that there may be multiple copies of the domain in a single PDB structure, since many structures contain multiple copies of the same protein sequence.
Loading structure mapping...